CleanCap® Cas9 Nickase mRNA (5moU)
Description
Cas9 Nickase mRNA expresses a version of the Streptococcus pyogenes SF370 Cas9 protein (CRISPR Associated Protein 9) that contains a D10A amino acid substitution. This mRNA also contains a C-terminal nuclear localization signal followed by a HA tag. Cas9 functions as part of the CRISPR (clustered regularly interspaced short palindromic repeats) genome editing system. In the CRISPR system, an RNA guide sequence targets the site of interest and the Cas9 protein is employed to perform the DNA cleavage. While wild-type Cas9 creates a double-stranded break at the target site, Cas9 nickase creates a single-stranded break. This favors homology-directed repair and decreases the occurrence of non-homologous end joining. This mRNA is capped using CleanCap® Reagent AG, TriLink's patented co-transciptional capping technology, which results in the naturally occurring Cap-1 structure with >95% capping efficiency. It is manufactured using TriLink's CleanScript™ method*, polyadenylated, modified with 5-methoxyuridine, and optimized for mammalian systems. It mimics a fully processed mature mRNA. CleanCap® Reagent AG produces a base-modified Cap-1 mRNA, which shows superior in vivo activity compared to Cap-0 mRNA produced by legacy capping methods such as mCap or anti-reverse cap analog (ARCA). 5-methoxyuridine is a modified uridine that can reduce immunogenic response and enhance the translational efficiency of mRNAs. These properties can result in safer mRNA and increased protein expression. CleanScript™ method is TriLink's proprietary in vitro transcription process that is optimized to minimize dsRNA formation and increase mRNA activity in vivo. *Starting April 30th, 2024
Product details
Catalog No | L-7207 |
Purity | Passes Agarose Gel Mobility |
Concentration | 1.0 mg/mL |
Buffer | 1 mM Sodium Citrate pH 6.4 |
Recommended Storage | At or below -40°C |
Application | CRISPR, Immunotherapeutics, Recombinases |
Base Composition | Fully substituted with 5-Methoxy-U |
Brand | CleanCap |
Cap Analogs | CleanCap AG |
Composition | Fully substituted with 5-Methoxy-U |
Conversion Factor | 40 µg/OD₂₆₀ |
length | 4498 nucleotides |
Phosphatase Treated | True |
Shipping Temp | Frozen |
Technical documents
- Safety Data Sheet Look-up open_in_new
- L-7207 Product Insert open_in_new
Product FAQs
They all contain an optimal 5_ Cap 1 found in higher eukaryotes for their functionality and stability. They also contain a synthetic 5_ UTR with a strong Kozak sequence for efficient translation and a 3_ UTR derived from mouse alpha-globin. Their key differences lie in the type of CleanCapÆ analog used and the sequence compositions, which may affect their protein expression and immunogenicity.
It is TriLink's proprietary in vitro transcription method that produces high-quality, high-yield mRNAs from a broad range of sequences. It has been optimized to minimize dsRNA and improve in vivo protein expression from the resulting mRNAs. Please see here for more information.
Our catalog mRNAs are intended for research use and manufactured with procedures in place to minimize endotoxin exposure. However, they are manufactured outside of a cleanroom and thus are not released with an endotoxin specification. †If you need mRNA released with an endotoxin specification or a higher grade of material, please contact mmrna-services@trilinkbiotech.com.
The sequence reported is just the ORF, start codon to stop codon, for our catalog mRNAs. It does not include the proprietary 5_ UTR, 3_ UTR, or the 120-nt poly-A tail. For full mRNA length and the length of the ORF please see the corresponding product insert.
Our catalog mRNAs are purified through DNase treatment to remove DNA templates, diafiltration to remove salts and small molecules, and oligo dT capture to remove impurities and retain species with poly(A) tails.
We do not carry Cy5-labeled mRNAs as catalog products. You may order them as a custom mRNA by completing this request form.
Our CleanCapÆ Cas9 mRNA, CleanCapÆ Cas9 mRNAs (5moU), and CleanCapÆ Cas9 mRNA (N1MePsU) contain an HA tag, 5_ TACCCCTACGACGTGCCCGACTACGCC 3_.
We use the dot blot test, which is a qualitative test to determine the relative amount of dsRNA present in a sample. Generally, this test is performed to assess dsRNA levels in mRNAs before and after RP-HPLC purification.
We minimize the dsRNA level in our ready-to-use mRNAs by incorporating stringent processes that consist of:
We look for a single main band running to approximately the correct length to pass the gel result. Some factors such as modified NTPs can make a sample run slightly lower than the expected size. Sometimes, sequence-related factors such as highly repetitive or UTP-rich regions (especially when modified UTP is used) can result in additional bands. We take account of all these factors to confirm that the mRNA was manufactured appropriately and the band is sequence specific before passing the results.
The fragment analyzer reports the percent of smear with a chromatogram. The smear analysis corresponds to the full-length integrity of an mRNA sample.
We start by cleaving the 5_ end of the mRNAs, then use LCMS to determine the mass of capped and uncapped species by the following formula:
We use 40 as the extinction coefficient for our mRNAs. Assigning a sequence-specific extinction coefficient for mRNA can be problematic due to its dependence on length and sequence composition. Factors like final buffer and temperature can also impact results. Thus, it is standard to use 40 for all mRNA species and not to calculate a coefficient for each sequence as you would with an oligonucleotide.
We recommend storing the mRNAs at -40° C to -80° C. To minimize freeze-thaw cycles, aliquot the sample into single-use quantities on the first usage. If kept under these conditions, our catalog mRNAs have been shown to maintain stability for at least 2 years.
Certificate of analysis
- Certificate of Analysis (CoA) open_in_new
Intellectual property
Products are for research use only, not for use in diagnostic or therapeutic procedures or for use in humans. Products are not for resale without express written permission from TriLink No license under any patent or other intellectual property right of TriLink or its licensors is granted or implied by the purchase unless otherwise provided in writing.
CleanCap capping technology
For Research Use Only. Not for use in humans. Not for use in diagnostic or therapeutic purposes. For additional licensing restrictions, please see the license agreement at trilinkbiotech.com/cleancap-research-license. Patents and patent pending, see trilinkbiotech.com/legal-notices.
CRISPR/Cas9 License
For research use only. Provided with a limited use license under licenses with The Broad Institute and ERS Genomics Ltd.
Related products
-
CleanCap® Cas9 mRNA (5moU) L-7206open_in_new
-
CleanCap® Cas9 mRNA L-7606open_in_new
-
CleanCap® M6 Cas9 mRNA (N1MePsU) L-8106open_in_new